Splice point

from Wikipedia, the free encyclopedia

A splice site ( English splice site ) provides the splicing the borders of exons and introns . Their sequence is only partially preserved , which is a prediction of exons only on the basis of DNA complicates sequence and a challenge in the bioinformatics represents.

properties

Splice sites are specifically recognized by the spliceosome and spliced out. In every intron there are three sequence areas that are important for processing by the spliceosome:

  1. The 5 'splice site
  2. The poly- pyrimidine tract with the branch point adenosine
  3. The 3 'splice site

A standard intron starts at the 5 'splice site usually with GUand ends at the 3' splice site at the most AG, this is the consideration at the RNA level. However, there are deviations from this sequence. The sequence occurs especially in introns that are processed by the so-called minor spliceosome 5' AU – AC 3', which is why they are also referred to as AUAC introns.

Vertebrates have the consensus sequence in the 5 'splice site and a poly-pyrimidine tract (10 or , followed by any base and ) and a terminal one as the 3' splice site . In the intron, the branch site is about 20 to 50 nucleotides above the 3 'splice site , which in yeast is usually the sequence (in vertebrates there are several variants). AGGUAAGUUCCAGUACUAAC

Individual evidence

  1. ↑ a b c Jeremy M. Berg, John L. Tymoczko, Lubert Stryer : Biochemie. 6 edition, Spektrum Akademischer Verlag, Heidelberg 2007. ISBN 978-3-8274-1800-5 . (free full text access) .