Paraglomerales

from Wikipedia, the free encyclopedia
Paraglomerales
Systematics
without rank: Opisthokonta
without rank: Nucletmycea
Empire : Mushrooms (fungi)
Department : Glomeromycota
Class : Arbuscular mycorrhizal fungi (Glomeromycetes)
Order : Paraglomerales
Scientific name
Paraglomerales
C. Walker & Schuessler

The Paraglomerales are an order of mushrooms with currently (as of May 2018) two families Paraglomeraceae and Pervetustaceae. They always form a symbiosis (mycorrhiza) with a large number of plants.

features

The Paraglomerales form unseptated , almost transparent or very pale hyphae in the soil and in the plant roots , they are very similar to those of the Archaeosparaceae , but differ in the shape of the spores , which are spherical (glomoid). Vesicles or arbuscules are formed within the root cells, the former only being observed rarely and only in Paraglomus brasiliaum . They differ genetically from other orders of Glomeromycota : They have the small subunit (SSU) rRNA gene sequence GCGAAGCGTCATGGCCTTAACCGGCCGT, which corresponds to the homologous position 703 of the Saccharomyces cerevisiae SSU rRNA sequence J01353.

Ecology and way of life

The mushrooms are almost always hypogean , i.e. H. growing in the ground. They always form a mycorrhiza symbiosis with a variety of plant species. They supply the plants with nutrients (especially phosphorus) and water and in turn receive part of the assimilates generated by photosynthesis .

Systematics

The Paraglomerales consisted of only one family and one genus until 2017 with only three currently known species. There are now 2 families with three genera (as of May 2018):

swell

  • Arthur Schüßler, Daniel Schwarzott, Christopher Walker (2001): A new fungal phylum, the Glomeromycota: phylogeny and evolution. Mycol. Res. 105: 1413-1421. doi : 10.1017 / S0953756201005196
  • Joseph B. Morton, Dirk Redecker (2001): Two new families of Glomales, Archaeosporaceae and Paraglomaceae, with two new genera Archaeospora and Paraglomus , based on concordant molecular and morphological characters. Mycologia 93: 181-195. doi : 10.2307 / 3761615

Web links

Individual evidence

  1. ^ A b Joseph B. Morton, Dirk Redecker: Two new families of Glomales, Archaeosporaceae and Paraglomaceae, with two new genera Archaeospora and Paraglomus , based on concordant molecular and morphological characters. In: Mycologia . tape 93 , 2001, p. 181-195 , doi : 10.2307 / 3761615 ( pdf ).
  2. ^ A b Arthur Schüßler, Daniel Schwarzott, Christopher Walker: A new fungal phylum, the Glomeromycota: phylogeny and evolution. In: Mycol. Res. Band 105 , no. 12 , 2001, p. 1413-1421 ( online , PDF).
  3. ↑ amf-phylogeny.com. Retrieved June 5, 2016 .
  4. ↑ Janusz Błaszkowski, Anna Kozłowska, Thomas Crossay, Sarah Symanczik and Mohamed N. Al-Yahya'ei: A new family, Pervetustaceae with a new genus, Pervetustus , and P. simplex sp. nov. (Paraglomerales), and a new genus, Innospora with I. majewskii comb. nov. (Paraglomeraceae) in the Glomeromycotina. In: Nova Hedwigia . tape 105 , no. 3-4 , 2017, pp. 397–410 , doi : 10.1127 / nova_hedwigia / 2017/0419 ( via researchgatepdf ).