Archaeorhizomyces
| Archaeorhizomyces | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Systematics | ||||||||||||
|
||||||||||||
| Scientific name of the class | ||||||||||||
| Archaeorhizomycetes | ||||||||||||
| Rosling & T. James | ||||||||||||
| Scientific name of the order | ||||||||||||
| Archaeorhizomycetales | ||||||||||||
| Rosling & T. James | ||||||||||||
| Scientific name of the family | ||||||||||||
| Archaeorhizomycetaceae | ||||||||||||
| Rosling & T. James | ||||||||||||
| Scientific name of the genus | ||||||||||||
| Archaeorhizomyces | ||||||||||||
| Rosling & T. James |
The Archaeorhizomycetes are a class of ashlar mushrooms newly described in 2011 with at the moment (December 2014) two described species ( Archaeorhizomyces finlayi and Archaeorhizomyces borealis ), but at least 100 different so-called " operational taxonomic units " (OTUs).
features
They differ from the sister class of the Taphrinomycetes by their growth on modified Melin Norkans Agar (MMN), and their association with the roots of living plants. In molecular genetic terms, the class is distinguished by the (AACAAGTAG) positions of the 60s subunit and the (T) position of the 40S subunit relative to Saccharomyces cerevisiae .
The genus is characterized by creamy white colonies on MMN agar, which grow slowly and appear feathery. In molecular genetic terms, the genus is distinguished by the (A) position of the 5.8S rDNA and the (GCATATCAATAAGGYGAGGA) position of the 40S subunit, the binding site of the ITS4 primer relative to Saccharomyces cerevisiae .
The type species Archaeorhizomyces finlayi forms colonies on the MMN medium with only a few hyphae and a feathery edge and was isolated from a mycorrhized root tip from a mixed coniferous forest . The mycelium consists of 1 to 2 µm thin hyphae with simple pore-free septa . In old age, 3 to 6 µm chlamydospores with up to four erect hyphae are formed. In terms of molecular genetics, the species has the following ITS properties: (TTTGGCGCCCGGTCTATGCC)
Ecology and diffusion
The Archaeorhizomycetes live on plant roots and in the rhizosphere and are cosmopolitan . Archaeorhizomyces finlayi has so far been isolated from Scandinavia and North America. They are believed to be found in many terrestrial ecosystems . Very little is known about their way of life. Initially it was thought that they get all of the carbon from the plant root. However, they do not form a known mycorrhizal structure. In addition, they can also grow on nutrient media with cellulose and glucose as the only carbon source. This indicates that they can at least be involved in the decomposition of organic matter and not get all of the carbon from the plant through symbiosis .
Systematics
The Archaeorhizomycetes form a class within the Taphrinomycotina and are at the base of the phylogenetic family tree of the sac fungi. They were not scientifically described until 2011. A second species, Archaeorhizomyces borealis, was described in 2014 .
etymology
ἀρχαῖος archaios means old, ancient, which refers to the basal position within the mushrooms. ῥιζο rhiza refers to the root, and μύκης mýkēs means mushroom. The epithet finlayi honors the Swedish mycologist Roger D. Finlay .
swell
- Anna Rosling, Filipa Cox, Karelyn Cruz-Martinez, Katarina Ihrmark, Gwen-Aëlle Grelet, Björn D. Lindahl, Audrius Menkis, Timothy Y. James (2011). "Archaeorhizomycetes: Unearthing an ancient class of ubiquitous soil fungi". Science 333 (6044): 876-9. doi : 10.1126 / science.1206958
Individual evidence
- ↑ Audrius Menkis, Hector Urbina, Timothy Y. James, Anna Rosling. 2014. Archaeorhizomyces borealis sp. nov. and a sequence-based classification of related soil fungal species. Fungal Biology 118: 943-955. doi : 10.1016 / j.funbio.2014.08.005 .