Primer design

The primer design ( IPA : [ ˊpʁaɪ̯mɐ dɪˈzaɪn ]) describes in biochemistry processes for the rational design of oligonucleotides for use as primers in a polymerase chain reaction or related methods. Primer design is a method for PCR optimization .

properties

DNA polymerases (also known as thermostable DNA polymerases ) require a hydroxyl group as a starting point for their first linkage reaction . With their 3'-OH end, primers provide a suitable hydroxyl function. Primers can consist of both DNA and RNA .

Also, in the in vitro - amplification of DNA, for example in the polymerase chain reaction (PCR) , the DNA sequencing or the reverse transcription , primers are required. The specific DNA segment to be amplified can be determined here with the aid of the primer.

Nucleotide sequences that flank the DNA segment to be amplified are therefore determined for the PCR. According to these sequences, suitable primer sequences are now produced by phosphoramidite synthesis . A primer represents the opposite strand to its “primer partner”. Primers for PCR approaches are usually 18–30 nucleotides in length. Various biotechnology companies now offer tailor-made primers for molecular biology applications. Through customized mismatch primer can be on the PCR technique also targeted mutations introduce genes for. B. exist in the exchange of an amino acid.

Secondary structures

The presence of guanosine or cytosine in the last five bases of a primer increases the specificity of the primer binding ( GC-clamp ). The primer sequence is compared with a database to avoid homologies . The sequence of the primer is checked for possible hybridizations with the same primer or with the other primer ( primer-dimer ) and secondary structures ( DNA hairpin , DNA hairpin loop) that can prevent correct primer binding. Since repetitions of one (English nucleotide runs 'nucleotide runs') and two nucleotides (English dinucleotide repeats 'dinucleotide repeats') can lead to incorrect primer binding, four or more such sequence motifs are also avoided.

Temperature conditions

Hybridization temperature ( also annealing temperature)

The primer used for the PCR (in the case of DNA sequencing ) or the primer pair (in the case of DNA amplifications) mostly consists of DNA. In the given context, hybridization is referred to as annealing , and the hybridization temperature is correspondingly referred to as annealing temperature T _a . That as well as the melting temperature T _{M of} a primer increase with its length. The optimal hybridization temperature is:

${\displaystyle T_{\mathrm {a} }=0{,}3\cdot T_{\mathrm {M} }+0{,}7\cdot T_{\mathrm {M} }'-14{,}9}$

where T _M 'is the melting temperature of the PCR product. T _M and T _M 'can be approximated using formulas given in the same source.

Melting temperature

Primers are designed with the aim of binding to the DNA template at a specific point and thus enabling targeted PCR products or hybridizations. In addition to the reaction conditions (temperature, buffer, concentrations of template and primer), the structure of the primer itself also plays a decisive role. The melting temperature ( T _M ) of a primer depends on its length and its composition (GC content). The length of the primer (typically 18 to 30 nucleotides) is chosen so that its melting temperature is suitable for the annealing temperature of the PCR or hybridization process (see sequence of a PCR reaction ). To increase the specificity of the PCR, the primer is usually designed in a length that corresponds to a melting temperature of five to a maximum of twenty degrees Celsius below the temperature of the elongation cycle of the polymerase used. Too low a melting temperature of the primer can lead to false positive results, too high a melting temperature of the primer leads to a lower efficiency of the hybridization and thus to a lower product concentration. The GC content plays a special role, since the double helix is more stable due to stacking interactions due to a high number of successive GC pairings . The melting temperature therefore increases with the number of G and C nucleotides. The melting temperature (in degrees Celsius ) can be calculated using several methods:

• the Wallace rule:

  ${\displaystyle T_{\mathrm {M} }=2\cdot (A+T)+4\cdot (G+C)}$

• the GC method is the simplest but also the most imprecise method:

  ${\displaystyle T_{\mathrm {M} }=64+41{\frac {G+C-16{,}4}{A+G+C+T}}}$

• the " salt adjusted " method is a little more precise and includes the concentration of Na ⁺ ions in the reaction mixture:

  ${\displaystyle T_{\mathrm {M} }=100{,}5+41\cdot {\frac {C+G}{A+C+G+T}}-{\frac {820}{A+C+G+T}}+16{,}6\cdot \log _{10}([\mathrm {Na} ^{+}])}$

• the most complicated method is the " base stacking " method, in which the enthalpy and entropy terms of the helix formation are included in the hybridization:

  ${\displaystyle T_{\mathrm {M} }={\frac {\Delta H{\frac {\mathrm {cal} }{\mathrm {mol} }}}{\Delta S+R\ln({\frac {\text{primer}}{2}})}}-273{,}15\ ^{\circ }\mathrm {C} }$

However, there is now a large number of software that can be used to calculate the melting temperature of primers.

Degenerate primers

Degenerate primers are used to amplify multiple homologous genes (in different species) or paralogous genes (within a species) with a primer pair. They also play a crucial role in the de novo sequencing of previously unknown gene sequences, even if the primer target sequences are also unknown.

In principle, degenerate primers are a mixture of similar primer sequences that are combined in a degenerate code. Degenerate primers can therefore still fit on a target sequence if it has changed in the course of evolution.

For example, this is the sequence

• 5'-NTAACGTATGCGATATCGGS-3 '

for a mixture of the sequences

• ATAACGTATGCGATATCGGC
• TTAACGTATGCGATATCGGC
• GTAACGTATGCGATATCGGC
• CTAACGTATGCGATATCGGC
• ATAACGTATGCGATATCGGG
• TTAACGTATGCGATATCGGG
• GTAACGTATGCGATATCGGG
• CTAACGTATGCGATATCGGG

since N for A, G, C or T and S for G or C stands.

Other IUPAC abbreviations are:

R: A or G (purines)

Y: C or T (pyrimidines)

W: A or T

K: G or T

M: A or C

B: C, G or T

D: A, G or T

H: A, C or T

V: A, C or G

In the case of degenerate primers, the primer design is a particular challenge. Primer properties and possible primer-primer interactions as well as possible target mispriming must be investigated separately for each of the possible sequences. A large number of different software tools have been specially developed for the design of degenerate primers based on alignments or consensus sequences (e.g. easyPAC)

Allele specificity

→ Main article : Allele-specific oligonucleotide

Allele-specific oligonucleotides can bind to certain SNPs .

Forward and reverse primer design

The primers that are used for a PCR must be designed and then ordered from a company. This has to be done anew with each PCR, as the gene that you want to copy changes with almost every PCR. However, it is a mistake to design just one primer. Since there are two strands, there is a forward and a reverse primer. A primer must meet certain requirements that can always change. Primers are designed as follows:

5 'ATGCTGCATGCATGTACGTACGTACGTAGTGCAGTGCAGTGACGACGTTGTGTGACC 3'

3 'TACGACGTACGTACATGCATGCATGCATCACGTCACGTCACTGCTGCAACACACTGG 5'

A primer must be made for each strand of DNA. However, it must be taken into account that the polymerase can only begin to synthesize at the 3 'end. The forward primer can be read off easily as it corresponds to the first bases of the 5'-3 'strand. So the forward primer is:

5 'ATGCTGCATGCATGTACGTA 3'

The reverse primer cannot be read directly. It must first be rewritten. This is the end of the 3'-5 'strand.

3 'CACTGCTGCAACACACTGG 5'

If you order the primer from a company you always get a primer in the 5'-3 'direction. So the strand has to be inverted to get the right one. If you want to use the primer in a PCR, it would otherwise not bind.

5 'GGTCACACAACGTCGTCAC 3'

Web links

• NCBI primer-BLAST . Retrieved September 3, 2013.
• Primer3 - Tool for primer derivation with many optimization options (English)
• Primerfox - Free Efficient Tool for Primer Derivation
• David Rosenkranz: easyPAC: A Tool for Fast Prediction, Testing and Reference Mapping of Degenerate PCR Primers from Alignments or Consensus Sequences. In: Evolutionary Bioinformatics. 8, 2012, S. EBO.S8870, doi : 10.4137 / EBO.S8870 . PMC 3310402 (free full text)

Individual evidence

1. ↑ LY Chuang, YH Cheng, CH Yang: Specific primer design for the polymerase chain reaction. In: Biotechnol Lett. (2013), PMID 23794048 .
2. ↑ K. Nybo: design primers. In: Biotechniques (2013), Volume 54, No. 5, pp. 249-250. PMID 23805429 .
3. ↑ ^{a b} W. Rychlik, WJ Spencer, RE Rhoads: Optimization of the annealing temperature for DNA amplification in vitro . In: Nucleic Acids Res . 18, No. 21, November 1990, pp. 6409-12. doi : 10.1093 / nar / 18.21.6409 . PMID 2243783 . PMC 332522 (free full text).
4. ↑ W. Rychlik: priming efficiency in PCR . In: BioTechniques . 18, No. 1, January 1995, pp. 84-6, 88-90. PMID 7702859 .
5. ↑ H. Telenius, NP Carter, CE Bebb, M. Nordenskjöld, BA Ponder, A. Tunnacliffe: Degenerate oligonucleotide-primed PCR: general amplification of target DNA by a single degenerate primer. In: Genomics. Volume 13, Number 3, July 1992, pp. 718-725, PMID 1639399 .
6. ↑ JA Iserte, BI Stephan, SE Goñi, CS Borio, PD Ghiringhelli, ME Lozano: Family-specific degenerate primer design: a tool to design consensus degenerated oligonucleotides. In: Biotechnol Res Int. (2013), p. 383646. doi : 10.1155 / 2013/383646 . PMID 23533783 ; PMC 3600133 (free full text).
7. ↑ Modern methods of genetic engineering. Retrieved April 20, 2020 .