T7 RNA polymerase
| RNA polymerase (phage T7) | ||
|---|---|---|
|
||
| according to PDB 1MSW | ||
|
Existing structural data: s. UniProt |
||
| Mass / length primary structure | 883 amino acids | |
| Identifier | ||
| Gene name (s) | 1 ( Entrez ) | |
| External IDs | ||
| Enzyme classification | ||
| EC, category | 2.7.7.6 , nucleotidyl transferase | |
| Substrate | Nucleoside triphosphate + RNA n | |
| Products | Diphosphate + RNA n + 1 | |
| Occurrence | ||
| Parent taxon | Caudovirales | |
The T7 RNA polymerase is the RNA polymerase from the phage T7 , a virus that attacks intestinal bacteria of the Escherichia coli species. The enzyme plays an important role in biotechnology in the expression of recombinant proteins , especially in E. coli but also in Bacillus subtilis and in pseudomonads .
function
The first RNA transcripts of the bacterial virus ( phage ) T7 are carried out with the host's RNA polymerase . Including the information for the translation of the very promoter-specific T7 RNA polymerase. T7's own polymerase only recognizes its own promoter and is therefore a very good method to assimilate the host's metabolism and use it for one's own reproduction. The T7 RNA polymerase, in combination with T7's own promoter, is a particularly "strong" expression system. This means that this promoter can produce a great deal of RNA and, as a result, often a lot of protein per copy on a DNA. T7 polymerase has a nucleotide addition rate of 200 to 260 nucleotides per second during the elongation phase of transcription (the normal E. coli RNA polymerase reaches about 40 nucleotides per second).
The T7 promoter
The T7 promoter has a specific sequence:
TAATACGACTCACTATAGGGAGA
whereby the transcription starts with GGGAGA. The promoter has almost no basal transcription . That is, in the absence of T7 RNA polymerase, it is almost impossible to read.
Application in biotechnology
The strength of the T7 expression system makes the T7 promoter and T7 polymerase very interesting for the expression of recombinant proteins. Therefore, there are now various vectors for protein expression that use the T7 system, such as the pET series.
As a rule, the T7 promoter sequence is located on a vector and behind it (in front of a necessary RBS) the coding region for a “ protein of interest ”. Since such an expression system would not be functional because of the reasons mentioned above (since no T7 polymerase is produced by the expression organism), the T7 polymerase must be artificially introduced into the system. The most common method for this is the genomic anchoring of a T7 expression cassette in the production organism . The most common organism used for this is E. coli . With him, the corresponding genotype, which indicates a genomic T7 polymerase, is called (DE3), since the T7 polymerase was integrated into the genome with the help of the "DE3 prophage". The expression of the T7 polymerase is under the control of the lac UV5 promoter, which can be induced by means of IPTG or lactose .
Problems using T7 expression systems
There are several problems that arise from using the T7 expression system:
The genomically anchored expression cassette used for the T7 RNA polymerase is not "tight", one speaks here of a so-called basal transcription. The result is that a certain amount of T7 polymerase is always present, which ensures that the production organism expresses protein even before the actual induction. This is particularly disadvantageous in the case of toxic products and it also means an unnecessary metabolic burden on the production organism. The addition of a lac operator to the vector between the promoter and the protein-coding sequence also shows little success here.
Another method is the genomic anchoring of a T7 lysozyme expression cassette (genotype designation in E. coli pLys ) or the addition of a corresponding plasmid. T7 lysozyme binds to T7 polymerase and inhibits it. However, this method also means an additional burden on the production organism and does not ensure optimal results in terms of basal transcription.
The latest developments are T7 strains that no longer have the DE3 genotype, i.e. they carry the T7 polymerase under the control of the lac UV5 promoter, but under much denser promoter systems such as the rhamnose or arabinose operon. In these strains, the T7 polymerase is only produced after the appropriate sugar has been added. This leads to a significantly lower basal transcription. However, since these sugars are relatively expensive compared to IPTG, such systems are not considered economical in the production of inexpensive recombinant products.
A second problem when using the T7 system is the strong overexpression of the “ protein of interest ”. The consequence of this is a high loss of product due to inclusion bodies .
In vitro use
Another important application is in vitro transcription with purified T7 RNA polymerase, ATP , CTP , GTP , UTP and a DNA template, which allows specific RNAs to be produced on a laboratory scale. The method, which also uses SP6 and T3 RNA polymerases, was developed by Douglas A. Melton . PCR products with the appropriate promoter or linearized recombinant vectors such as pGEM-T Easy are used as templates. The RNAs are used, among other things, for in vitro translation , injection into oocytes and in situ hybridization .
literature
- Martin CT, Esposito EA, Theis K, Gong P: Structure and function in promoter escape by T7 RNA polymerase . In: ... Prog Nucleic Acid Res Mol Biol. . 80, 2005, pp. 323-47. doi : 10.1016 / S0079-6603 (05) 80008-X . PMID 16164978 .
- Sousa R, Mukherjee S: T7 RNA polymerase . In: ... Prog Nucleic Acid Res Mol Biol. . 73, 2003, pp. 1-41. doi : 10.1016 / S0079-6603 (03) 01001-8 . PMID 12882513 .
- McAllister WT: Structure and function of the bacteriophage T7 RNA polymerase (or, the virtues of simplicity) . In: Cell. Mol. Biol. Res. . 39, No. 4, 1993, pp. 385-91. PMID 8312975 .
- Sastry SS, Ross BM: Nuclease activity of T7 RNA polymerase and the heterogeneity of transcription elongation complexes . In: J. Biol. Chem . 272, No. 13, March 1997, pp. 8644-52. doi : 10.1074 / jbc.272.13.8644 . PMID 9079696 .
- Garabed Antranikian: Applied Microbiology . Springer, Berlin / Heidelberg 2006, ISBN 3-540-24083-7 .
Individual evidence
- ↑ Homologues at NCBI
- ^ FW Studier: Use of bacteriophage T7 lysozyme to improve an inducible T7 expression system. In: Journal of molecular biology. Volume 219, Number 1, May 1991, pp. 37-44, PMID 2023259 .
- ↑ PA Krieg, DA Melton: Functional messenger RNAs are produced by SP6 in vitro transcription of cloned cDNAs. In: Nucleic acids research. Volume 12, Number 18, September 1984, pp. 7057-7070, PMID 6207484 , PMC 320142 (free full text).